86
|
Cowin Biosciences
prime script real time pcr kit Prime Script Real Time Pcr Kit, supplied by Cowin Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/kit+pcr+prime+real+script+time/pm41900422-107-20-25 Average 86 stars, based on 1 article reviews
prime script real time pcr kit - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
90
|
5 PRIME
5× prime script buffer2 (for real time) 5× Prime Script Buffer2 (For Real Time), supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/5%C3%97+prime+script+buffer2++for+real+time+/pmc11013177-244-24-23 Average 90 stars, based on 1 article reviews
5× prime script buffer2 (for real time) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gene script qrt-pcr primer designer Gene Script Qrt Pcr Primer Designer, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/qpcr+primers/pmc08495223-112-9-15 Average 90 stars, based on 1 article reviews
gene script qrt-pcr primer designer - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
99
|
New England Biolabs
prime script mmlv reverse transcriptase Prime Script Mmlv Reverse Transcriptase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/M-MuLV+Reverse+Transcriptase/pmc09839780-624-13-47 Average 99 stars, based on 1 article reviews
prime script mmlv reverse transcriptase - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
90
|
5 PRIME
real master script super mix kit Real Master Script Super Mix Kit, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/perfectpure+rna+cultured+cell+kit/pmc06639781-60-27-33 Average 90 stars, based on 1 article reviews
real master script super mix kit - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
gen script-real time pcr primer design tool Gen Script Real Time Pcr Primer Design Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/pcr+primer+design+software/pm37798613-84-14-18 Average 90 stars, based on 1 article reviews
gen script-real time pcr primer design tool - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
maze forward: ccagtcgatattctcgtgga Maze Forward: Ccagtcgatattctcgtgga, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/maze+forward++ccagtcgatattctcgtgga/pm28062294-52-8-12 Average 90 stars, based on 1 article reviews
maze forward: ccagtcgatattctcgtgga - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |