gen script-real time pcr primer design tool Search Results


86
Cowin Biosciences prime script real time pcr kit
Prime Script Real Time Pcr Kit, supplied by Cowin Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/kit+pcr+prime+real+script+time/pm41900422-107-20-25
Average 86 stars, based on 1 article reviews
prime script real time pcr kit - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
5 PRIME 5× prime script buffer2 (for real time)
5× Prime Script Buffer2 (For Real Time), supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/5%C3%97+prime+script+buffer2++for+real+time+/pmc11013177-244-24-23
Average 90 stars, based on 1 article reviews
5× prime script buffer2 (for real time) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation gene script qrt-pcr primer designer
Gene Script Qrt Pcr Primer Designer, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/qpcr+primers/pmc08495223-112-9-15
Average 90 stars, based on 1 article reviews
gene script qrt-pcr primer designer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
New England Biolabs prime script mmlv reverse transcriptase
Prime Script Mmlv Reverse Transcriptase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/M-MuLV+Reverse+Transcriptase/pmc09839780-624-13-47
Average 99 stars, based on 1 article reviews
prime script mmlv reverse transcriptase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
5 PRIME real master script super mix kit
Real Master Script Super Mix Kit, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/perfectpure+rna+cultured+cell+kit/pmc06639781-60-27-33
Average 90 stars, based on 1 article reviews
real master script super mix kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc gen script-real time pcr primer design tool
Gen Script Real Time Pcr Primer Design Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/pcr+primer+design+software/pm37798613-84-14-18
Average 90 stars, based on 1 article reviews
gen script-real time pcr primer design tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc maze forward: ccagtcgatattctcgtgga
Maze Forward: Ccagtcgatattctcgtgga, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gen+script-real+time+pcr+primer+design+tool/maze+forward++ccagtcgatattctcgtgga/pm28062294-52-8-12
Average 90 stars, based on 1 article reviews
maze forward: ccagtcgatattctcgtgga - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results